bowserjr1206
bowserjr1206 bowserjr1206
  • 25-01-2021
  • Mathematics
contestada

√8 x √2 = 10 - 3 x 4 1/2

Respuesta :

Erriyanakennedy1 Erriyanakennedy1
  • 25-01-2021

Answer:

Exact Form:

2√2

Decimal Form:

2.82842712

i think

Answer Link
hana758 hana758
  • 25-01-2021
2 roots 2.............
Answer Link

Otras preguntas

Which of the following processes most directly helps create soil from rocks? A. pressure B. melting C. plate tectonics D. weathering
What was the main reason that the Aztecs became very powerful in the fifteenth century? A. They created new products to trade with other groups. B. They con
Write the number 4.2 x 10^2 in standard form.
The base of a right rectangular pyramid has length 24 ​cm, width 18 ​cm, and height 13 cm. Describe a cross-section that could be formed by a horizontal plane t
Studies involving communication between infants and caregivers have reliably demonstrated that ________. Group of answer choices: A) Without sufficient interac
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
30 Points!!! What is the simplified form?
Which expression can be used to find the volume
The dimensions of a parking lot are measured in feet. What units will the area be measured in? A) feet/\4 B) feet/\3 C) feet D) feet/\2
What is a faulty parallel structure?