helenirby1964 helenirby1964

22-05-2020
Chemistry

contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof

22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

Canada has a population that is about one tenth of a large is the United States and Canada's population is about 32 million about how many people live in the Un

73569 round to the ten thousand place

In April 1940, Germany launched a surprise invasion of neutral __________. Select one of the options below as your answer: a. France b. Spain and Portugal c. Yu

read and write the number in two other forms 600,000 plus 80,000 plus 10

Solve 9x-7y=-7 i don't know how to do it so could you show me step by step please

If q=2. Evaluate (34+18*q)-(5q+7)

how long does a car traveling at 70 mph take to travel 88 miles, in hours

The declaration of war in 1812 was strongly opposed by: a. New England merchants b. the War Hawks c. western farmers d. southern Republicans

The tightening of credit and a sharp decrease in farm prices touched off the Panic of 1819. a. True b. False

there are 8 students on the minibus five of the students are boys what fraction of the students are boys