che0rezRylene che0rezRylene
  • 21-10-2016
  • English
contestada

The following question refers to “the cask of amontillado.” which term best describes montresor’s personality? miserly vengeful conceited friendly

Respuesta :

Аноним Аноним
  • 27-10-2016
"Vengeful" because he wanted revenge after Fortunado offended him.
Answer Link
lhartman1948oxpx80 lhartman1948oxpx80
  • 19-10-2018

Vengeful would be the answer, I already did this question. :)

Answer Link

Otras preguntas

in a classroom of 33 students, the ratio of boys to girls is 3 : 8. How many boys are in the class?
Which quadrant or axis is (8,0)
This is a simple biological process not requiring oxygen.
I need help with this and FAST please!!!!
Which statement about longitude and latitude is true? A. Latitude measures the distance from the equator. B. Longitude measures the distance from South America.
How do you turn a percent into a fraction
DNA tacaggtacccgaacccaattta
The use of force to move an object is "_____".
A farmer can harvets 2 1/3 acres of corn in 1 day. How many days will it take to harvest 10 1\2 acres
Write an expression for 105.067 in expanded form by multiplying each digit by a decimal fraction