cupcake225 cupcake225

25-04-2018
Mathematics

contestada

Write the expression in factored form 25x^2-y^4

A) (5x+y) (5x-y^2)
B) (25x-y^2) (x+y^2)
C) (5x-y^2)^2
D) (5x+y^2) (5x-y^2)

Respuesta :

TheGreatWulfbite TheGreatWulfbite

25-04-2018

The answer is D. (5x+y²)(5x-y²)
This is because of multiplication; and this factorization is the only one that multiplies to the given equation.

Answer Link

Otras preguntas

What is the factorization of the trinomial below? 3x3 - 18X2 + 24x

Which line from the passage best represents an external conflict?

PLEASE ANSWER OFFERING BRAINLEST PLEAS PLEASE PLEASE ANSWER Triangle MNQ is similar to triangle MLP. Determine the length of LP. a. 2 inches b. 9 inches c. 12

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

What can cause alterations to skin color? Select ALL that apply. A) emotional changes B) aging C) infections D) sun exposure E). injuries

Can someone write a description about Athens

PLEASE HELP ILL GIVE BRAINLIEST

Please help me- anatomy

What is the inverse of: f (x) = 9x - 4 O f'(x) = * Of-'(x) = 4 Of(x) = x + 4 of'(x) = 6

Why did Francisco Vazquez de Coronado believe that his expedition to Quivira had failed