ryleeyeahthatsme17 ryleeyeahthatsme17

23-02-2018
Biology

contestada

what is the term for a red clay soil commonly found in the southeastern portion of the United States?

Respuesta :

Аноним Аноним

23-02-2018

I believe it is terra cotta. Hope it helps! :)

Answer Link

Otras preguntas

which one of the statements is true

suppose you were to grind the up and homogenate a pancreas. Do you think it would be possible to isolate insulin from this homogenate?

An essay that uses the words first, next, and finally indicates what type of organization?

Imagine a situation in which the number of urea leak channels increased dramatically in the ascending limb of the loop of Henle. What could be one likely conseq

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1.What process is used to replicate the chromosomes? 2.Are the sister chromotids genetically identical? Explain.

Write a recursive function for this sequence 8,12,18,27..

A 15.6 grams of ethanol absorb 868 J as it is heated. The initial temperature is 21.5 degrees Celsius. What is the final temperature if the specific heat of eth

Who discovered polio vaccine

What is the effect of using scaffold proteins on precision and amplification capacity in cell signaling?