tayphil2011 tayphil2011
  • 23-01-2024
  • Mathematics
contestada

How many parts must the factory produce so that there is 1 ton of scrap aluminum for recycling?

Respuesta :

jesusismyFather jesusismyFather
  • 23-01-2024

Answer:

To determine the number of parts needed to produce 1 ton of scrap aluminum for recycling, I would need information about the weight of aluminum used in each part and the percentage of scrap generated during the manufacturing process. Could you provide those details?

Answer Link

Otras preguntas

how is the monarchy in belgium? Thank!!!
An example of an unbalanced force is A. a bridge. B. a roller coaster going down the first drop. C. a tug of war game in which no one wins. D. a ca
Which word has a similar connotation to the word “swallow” in this excerpt?
What the difference 7 7/8 and 3 1/2
¿Qué te gusta hacer? Question 20 options: Me gusta montar en monopatín. No me gusta tampoco. No, no me gusta. A mí también.
write the transformed function of the given parent function quadratic function translated up to 2 units
hi i am on the student board committee at my school and I'm having to ask people their thoughts on the LGBT+ community i have to turn it in tomorrow would you
Haley had an 8 pt per game average in may and a 10 pt per game average in june. What is her percent increase
Help with my geometry hw please :/
DNA tacaggtacccgaacccaattta