nubialatina nubialatina

24-04-2014
Mathematics

contestada

how do you estimate 12.062g to the nearest tens of a gram

Relax

Respuesta :

Dannymal Dannymal

24-04-2014

12.602 = 10g
or if you meant tenTHs it will be 13g

Answer Link

Otras preguntas

Given that x and y vary inversely and that y is 8 when x is 2, what is the value of x when y is 18?

What is a group of design theory?

Please help with 4 and 5, thank you :)

Plz help me with this question plz

ways in which landscape can be created .plz answer this

We want to find the zeros of this polynomial: p(3) = (x + 2)(2x - 3)(3-3) Plot all the zeros (x-intercepts) of the polynomial in the interactive graph

Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands

Which of the following statements about Latin America’s highland climate region is false? A. It stretches along the western side of the entire region. B. The te

Pleaseeeee answer I will mark brainliest for best answer ^>^

Is Sustainable development possible? Is sustainable development worth try to achieve? Why?Why not?