jj1241 jj1241
  • 25-04-2017
  • History
contestada

What was the shortest battle in us history


No google search

Relax

Respuesta :

katyyyyyus
katyyyyyus katyyyyyus
  • 25-04-2017
its The Spanish-American War of 1898 
Answer Link

Otras preguntas

If a person has Rh+ blood they can receive ____ blood. A. Rh+ B. Rh- C. Rh+ or Rh-
The function of a bony process is to provide a... A. Passage for blood vessels B. Place of attachment for tendons and ligaments C. Smooth surface for articula
please guys......................
Which property is illustrated? 15 + (5 + 7) = (15 + 5) + 7
forget about this one and also didn't know you couldn't delete it. oops
I really need help doo doo doo doo I really need help doo doo doo doo I really need help doo doo doo doo I really need help!
What did sir Edwin Sandy’s hope for when he set up the headright system and indentured servitude in Jamestown
DNA tacaggtacccgaacccaattta
Why did Napoleon bring back catholic church's in france?
The county official most directly responsible for providing public safety is the