imswegy
imswegy imswegy
  • 23-03-2017
  • Mathematics
contestada

I need the answer urgently plz

I need the answer urgently plz class=

Respuesta :

BellaMcNulty BellaMcNulty
  • 23-03-2017
To find the length of the base, you must first find the length of the sides, or the value of x. Because it is an isosceles triangle, the legs are equal to each other. 

2x + 4=x + 8
x=4

Now that you have found x, plug it into the equation for the base. 

5(4) - 2
20 - 2
18
Final Answer: 18

Hope this helps!! :)




Answer Link

Otras preguntas

PLEASE HELP! (GEOMETRY HIGH SCHOOL) Select all the statements about the diagram that you cannot conclude. (I know the ones I selected are correct, but I would a
Suppose that the federal government decides to increase the excise tax on cellular phone services by 0.1 percent. Why will this action cause the equilibrium p
Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Estimate the cost of 2.16 kg of bananas at $3.84 per kg
Core inflation rate- pls help
Match the vocabulary word with its definition. 1. (of some number N) is the number which, when squared, gives you N 2. opposite operations that undo one another
Solve the following quadratic equation using the zero product property. 2(6-x)(x+5)=0
How do interest groups use propaganda to persuade people to their view point?
Why should France pursue a policy of imperialism?
This Frankish strategist defeated the Moors at the Battle of Tour.