gpiccione74 gpiccione74

23-10-2022
Mathematics

contestada

23. What is the mode of the following numbers, and what word can be used to describe the
distribution of the data set?
5, 4, 10, 3, 3, 4, 7, 4, 6, 5, 11, 9, 5, 7

Respuesta :

Otras preguntas

1. About how many years make up each generation?

How does saliva maintain the pH of the mouth after bacteria produce acid from the carbohydrates we’ve consumed?

4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please

The senior students have large lockers that line the school's southern hallway in a single row. A group of 7 friends agreed to choose lockers next to each other

Gabi Gram started The Gram Co., a new business that began operations on May 1. The Gram Co. completed the following transactions during its first month of opera

Find the distance between (1, 2) and (-3, -2)

HELP ASAP GIVING BRSINLIST

When the narrator prepares his canoe for the trip to pick up Sheila and take her to the dance, he automatically puts his fishing rod in the canoe and later auto

If cut a pie into 10 equal size pieces, and then I of those pieces, what is the numerator and the denominator of the fraction representing the amount

30 mm 72 mm What is the length of the hypotenuse?