mya691442
mya691442 mya691442
  • 26-03-2022
  • Mathematics
contestada

solve pls brainliest

solve pls brainliest class=

Respuesta :

youngws2000
youngws2000 youngws2000
  • 26-03-2022

Answer:

1/4

Step-by-step explanation:

20n=5

n=5/20

n=1/4

therefore, it's 1/4

Answer Link
Аноним Аноним
  • 26-03-2022

Answer:

1/4th

Step-by-step explanation:

All we need to do is get the N by itself, and since the 20 is multiplied by the N, we would divide to get rid of it on both sides. then we have n=5/20, and since 5 goes into 20 4 times, we can simplify it to 1/4th.

please mark as brianlest.

Answer Link

Otras preguntas

A parking lot in the shape of a trapezoid has an area of 12,052.1 square meters. The length of one base is 82.4 meters, and the length of the other base is 108.
Translate these lines from the poem. "Bot wold ye, lady louely, then leue me grante Nay, for sothe, beau sir, sayd that swete" WOW, I'M LOST!! #ihatemyenglishc
Use these words in a sentence proton neutron and isotope
If 1+4=5 and 2+5=12 what does 8+11=
need help ASAP! A state park is designed in a circular pattern as shown. Mia runs along the circular path from the tennis courts to the petting zoo. How far doe
The europhoric state caused by is due to a dangerous lack of oxygen to the brain
how to find the average range of cells A1:A10
Find the mean of these values 6,4,8,2,5
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how many atoms are present in 4.0 mol of sodium