datazip2003 datazip2003

22-01-2017
Mathematics

contestada

What percentage of the original amount of Polonium-210 would be left after 600 days of decay?

Respuesta :

22-01-2017

You need the decay constant, lambda,

[tex]N=N_0e^{-\lambda t} [/tex]

After 600 days, and supposing you have t in days and some realtion between N and N0

[tex]\%=100(N_0/N)e^{-\lambda t}[/tex]and lambda in 1/days, then

Answer Link

Otras preguntas

Why are they called SH2 domains?

What two countries on opposite sides of the ring of fire were shaken by major earthquakes last weekend

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what the decimal of 2 1/4

which one of the statements is true

physical components are connected to a cpu via the motherboard in all the following ways except

in millions of british pounds how much did germany spend in 1890

if if x+y=10, find the value of y when x=3

The school's computer lab goes through 5 reams of printer paper every 6 weeks. Find out how long 6 cases of printer paper is likely to last (a case of paper hol

During the 1800s, the nations supply of currency was tied to its national reserves of either gold or silver. In 1900, an act was passed by congress that would s