snoopcat10 snoopcat10

26-01-2022
Chemistry

contestada

PLEASE HELP!!!

Calculate the amount of heat required to melt 100g of ice at 0°C?

Respuesta :

26-01-2022

Converting 100. g of ice at 0.00 °C to water vapour at 100.00 °C requires 301 kJ of energy.

Answer Link

aaronsuarez aaronsuarez

26-01-2022

Answer:

301 kj amount of energy is needed to melt 100g grams of ice in 0 degrees celcius

Explanation:

Answer Link

Otras preguntas

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

RNAi Choose one: A. allows host cells to remember infection by copying small sections of viral DNA into RNA. B. occurs at random leading to the prevention of

Menso is an organisation for people with high Intelligence Quotients (IQs). Menso is investigating the average IQ of primary school students to determine whethe

Find the surface area of the trapezoid below

All living cells have what feature in common? A. Chloroplasts B. Cell walls C. Membranes D. Lysosomes

Assume that x is a double variable that has been given a value. Write a statement that prints it out with exactly three digits to the right of the decimal poi

In a study by Williams, a 20-month-old child was making life miserable for his parents by having temper tantrums when put to bed. If the parents stayed up with

what do you mean by janto? write its working principle.

Which characteristic best describes a tropical climate zone? A. Thick ice sheets B. Direct sunlight C. High latitude D. High altitude

A middle-aged client is admitted to the hospital for hematuria. The client has no previous history of illness, is married, and has three children in high school