Firefalme Firefalme
  • 25-01-2022
  • Arts
contestada

how long does it take for the earth to orbit the sun

Respuesta :

cupcakegirll
cupcakegirll cupcakegirll
  • 25-01-2022

Answer:

365 days

Explanation:

: Earth revolves around the sun in 365 days, 5 hours, 59 minutes and 16 seconds. The time a planet takes to revolve around the sun is called a year.

Ver imagen cupcakegirll
Answer Link
danabagherifard danabagherifard
  • 25-01-2022

Answer:

365 days it takes

Explanation:
like 1 year

Answer Link

Otras preguntas

What is the term for common people of the Roman Empire
HELP ASAP 2 QUESTIONS 20 POINTS There are 35 red marbles, 8 blue marbles, and 7 green marbles in a bag. What is the theoretical probability of randomly drawing
1. Kelly’s Couture made the following purchases of sweaters during the year: Beginning Inventory........25 at $35 each March.............................20 at
True or false all fungi have chitin in their cell walls
What is one result of the Maya's advanced writing system?
There are different ways to think about the meaning of speed. Which description correctly completes this sentence? Speed is ________________________. A.time tra
What is 24+54 written using gcf and the distributive property
What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt
Of the following, what is the greatest expenditure? Transportation Education Social Security Energy
Explain how a hormone may cause its effect on plant growth and development.