lexivelarde200 lexivelarde200
  • 23-06-2021
  • English
contestada

Need help ASAP !!
A
B
C
Or D

Need help ASAP A B C Or D class=

Respuesta :

s908419 s908419
  • 23-06-2021

Answer:

a

Explanation:

yes.

Answer Link

Otras preguntas

If you saw this strand of DNA how many base pairs would be in thestrand?aagcttctgaatcagttcgaagacttagtc​
Can someone write me a Spanish essay. Everything I need is below It need to be a fairytale and it needs to be short about 3-5 sentences
polymers are made up of individual subunits called
Milo Manufacturing uses straight-line depreciation for financial statement reporting and is able to deduct 100% of the cost of equipment in the year the equipme
A proton is traveling south as it enters a region that contains a magnetic field. The proton is deflected downward toward the earth. What is the direction of th
If one kilogram is 2.2 pounds how many kilograms would it make for 11 pounds
When multinational enterprises enter host countries such as Saudi Arabia and Japan, the most logical option is usually to pursue a multidomestic strategy even t
the antonym of a meaningless gesture
_ The cell walls of bacteria, fungi, and plant cells and the extracellular matrix 0119animal cells are all external to the plasma membrane. Which of the followi
Ellen has 150 books. She wants to store an equal number of books in 2 containers. How many books should Ellen put in each container?