xoitzjayla1
xoitzjayla1 xoitzjayla1
  • 25-05-2021
  • Mathematics
contestada

help please!!!!!!!!!!!!!!!!!!!!​

help please class=

Respuesta :

Аноним Аноним
  • 25-05-2021

Answer:

[tex]{ \boxed{a = 3.75}}[/tex]

[tex]{ \boxed{b = 16}}[/tex]

Step-by-step explanation:

[tex](4.46 \times {10}^{9} ) \times (8.4 \times {10}^{6} ) \\ = 3.7464 \times {10}^{16} \: breaths[/tex]

Answer Link

Otras preguntas

According to government documents in 2002, the percentage of individuals who admitted to consistently going more than 10 miles per hour on the interstate was 36
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid
A swimmer heading directly across a river that is 200 m wide reaches the opposite bank in 6 min 40 s. During this swim, she is swept downstream 480 m. How fast
What is the area of the sector that is not shaded? 0 12 tt units O 24 tt units? 0 120rt units O 144rt units?
“[He] set up a printing house of his own from which he published ‘The Pennsylvania Gazette,’ to which he contributed many essays, and which he made a medium for
anyone wants to do dirty zoo m​
decrease 150km in the ratio 2:5​
How to make RESEARCH REPORT valid and reliable?​
which sultan of ottoman empire was beautiful ?kosem sultan Hürrem Sultan​
1. Find the least common multiple of 6 and 9. oct common multiple of​