altheavilla12
altheavilla12 altheavilla12
  • 25-05-2021
  • History
contestada

Why is it important to learn about its brutality in history

Respuesta :

christinaarett
christinaarett christinaarett
  • 25-05-2021
There are many reasons. Firstly, it is necessary because having a negative connotation on brutality and such will make new generations far more unlikely to partake in such an act. Others will also probably consider what they learned if they wanted to support someone like that. You don’t want history to repeat itself, and you want to educate yourself on those who experienced it.
Answer Link

Otras preguntas

find the zeros of the function f(x) = (x+3)^2-4=0
A food establishment that serves oysters should have what.
PLEASE HELP! I WILL GIVE 50 POINTS!!! A radar gun measured the speed of a baseball at 92 miles per hour. If the baseball was actually going 90.3 miles per hour,
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
0 다. II 2 3 5 101 1 Using the alleles A and a, what is the genotype of individual a) 11-6 b) 1-4 11-7
Each day, the Royal Chocolate Master puts all of the candies he makes in boxes with the same number of candies in each box. Today the Queen wants him to put 30
Match the cultural belief to the correct religion Buddhism, Judaism, Islam,Christian Science,Confucianism
Which of the following is not a type of biodiversity?.
What does 33y mean if y is 18?
the intensity of an earthquake is directly related to its distance from the epicenter?