supreme2kgod5678 supreme2kgod5678

23-04-2021
Social Studies

contestada

In order for conduction to occur two objects must be what
A)moving

B)far apart

C) touching

D) made of liquid or gas

Respuesta :

Nexiilingod Nexiilingod

23-04-2021

Maybe c or a

Correct me if I’m wrong

Answer Link

Otras preguntas

a particle travels along a straight line with an acceleration of a = (10 - 0.2s) m>s 2 , where s is measured in meters. determine the velocity of the particl

4 Emily's cable television bill is $212 a month. How much does it cost Emily to have cable television for a year? (1 Point) a. $2,120 b. $2,500 O c. $448 d. $2,

find the surface area

which type of scale would be appropriate to prioritize a requirement that is mission critical?

A final settling tank for a 2 MGD activated sludge treatment plant has an average overflow rate of 800 g/day-ft2. The tank needs to have a minimum detention tim

Determine the voltage dropped on R3, given: ET = 1325 V, R1 = 76 Ω, R2 = 61 Ω, R3 = 30 Ω, and R4 = 30 Ω

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

A 24 tooth pinion has a module of 2 mm, rotates 2400 RPM and drives a 800 RPM gear. Determine the number of teeth on the gear, the circular pitch, and the theor

An object is placed 5.0 cm to the left of a converging lens that has a focal length of 20 cm. Describe what the resulting image will look like (i.e. image dista

Given the ellipse: x^2/9 + y^2/25 = 1 (a) Find the coordinates of the two focal points. (b) Find the eccentricity of the ellipse