tanyasingh21
tanyasingh21 tanyasingh21
  • 26-03-2021
  • Biology
contestada

Help me plz asap 2-4 plz

Help me plz asap 24 plz class=

Respuesta :

annaclaire946
annaclaire946 annaclaire946
  • 26-03-2021

Answer:

1.mRNA- ATGAAAAGGTCCGTGGGAACTAAACAACACTAA

2.MRNA- ATGAAAACGGTCCGTGGGAACTAAACAACACTAA

3. ??

4. It will affect the protein so the leg wont have enough protein or have too much.

Explanation:

Answer Link

Otras preguntas

A marketing research company is estimating which of two soft drinks college students prefer. A random sample of n college students produced the following 95% co
Who created dn? Explanation will be needed.
What is the slope of the line?
A carpenter cut three 4ft 6in shelves from a 14ft board. How long a piece was left over?.
What is the product of using scientific notation to solve the problem of 20.5 * 10 to the 7th power and 0.000036
Which of the following describes ladue's feelings about his actions?.
The Reformation was a period in history that emphasized knowledge, learning and understanding of science, governments and natural rights. A: True B: False
______ is an example of a TCS food. A whole watermelon Chicken Bread Uncooked (dry) rice
Matarmeans _____. To cut to kill to order to drink.
5. What is intellectual property? (1 point) Brainliest if correct