therreallee therreallee

26-02-2021
History

contestada

just need help with question #5 pls

just need help with question 5 pls class=

Respuesta :

Podetola Podetola

26-02-2021

Answer: 1

Explanation:

The main goals of gerrymandering are to increase the effect of supporters' votes and to decrease the effect of opponents' votes.

Hope it helps!

Answer Link

selenah1260 selenah1260

26-02-2021

Answer:

I think the answer is 2 reduce the number of voters

Answer Link

Otras preguntas

Your friend Ed refuses to use networking to get a job. He wants to get hired based on his merits and not on whom he knows. Do you agree or disagree with Ed?

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

If dy dx equals cosine squared of the quantity pi times y over 4 and y = 1 when x = 0, then find the value of x when y = 3.

PLEASE HELP!!! What are the roots of 3x^2 + 10 = 4x???

Please help fast. J hjddhdhhfhdhdhdhdhdhdhdhdhdjddhd

In ammonia, a central nitrogen atom is bonded to three hydrogen atoms. Similarly, boron trifluoride has a central boron atom bonded to three fluorine atoms. How

How does the slope of g(x) compare to the slope of f(x)?/

describe how oxygen gas and carbon dioxide create a cycle within the ocean HURRY 40 POINTS!!!!!!!!!!!!!!!!!!!!!!!!!! Give to BRAINLIEST ANSWER

BRAINLIEST TO BEST Which function grows at the fastest rate for increasing values of x? A) f(x)=12x^2+4x B) h(x)=4^x C) g(x)=100x D) p(x)=3x3+1

Which of the following goods is commonly considered a staple convenience good by many people in the U.S.? A. A car B. Toilet paper C. A television D. Specialty