madison829 madison829

23-02-2021
Social Studies

contestada

what was a result of the changing economy of the North during the mid 1800

Respuesta :

kiraanderson612 kiraanderson612

31-03-2021

Answer:

The working class grew as more people went to work in factories

Explanation:

Since manufacturing was very important in the North, and the factories needed so many people to work.

Hope that was enough!

Answer Link

Otras preguntas

_______ weathering is generally more important at higher elevations, and _______ weathering predominates in lowlands.

Research suggests that laughter improves people’s emotional and physical well-being. Write a research-based essay to inform the reader about the positive effect

Which excerpt from the passage best supports that agatha valued the opinions of the gods and goddesses more than the opinions of any human?.

in what step did audrey make her mistake in

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Which of the following lines are perpendicular to the line y= -1/2x +4 ? (you may choose more than one answer) A. 2x - y = 1 B. y = 2x C. 2x + y = 1 D. 1/2x - y

PLEASE HELP ASAP!!!!

3. Mama has her opinions about things concerning Walter. Determine which statements are TRUE/FALSE about what Mama thinks.

True or False: The Judiciary Act of 1789 weakened the Judicial Branch compared to the other two branches.

A(n) __________ character is a universal character type that is common across different genres of literature.