annynascimento44
annynascimento44
22-01-2021
Mathematics
contestada
I need helppp!!!
−50=10s
Respuesta :
myaleidl
myaleidl
22-01-2021
Hey the answer is -0.2. You have to divide 10 by both sides to isolate the variable
Answer Link
VER TODAS LAS RESPUESTAS ( 31+ )
Otras preguntas
Mrs. Joyce baked apple pies for her family. The boys ate 2/3 of a pie and the girls ate 1/2 of a pie. How much more pie did the boys eat than the girls?
Lowell girls had to work extended hours and risk body harm at which location? Textile factories making clothes Fishing industry on vessels Plantation for cash c
88 books cost \$19.60$19.60dollar sign, 19, point, 60. Which equation would help determine the cost of 101010 books? Choose 1 answer: Choose 1 answer: (Choice A
Write an equation in point-slope form of the line that passes through the point (5, 1) and has a slope of -3
Using the above transformations, identify the rotation, reflection and translation. Compare and contrast each of the transformations. How would you describe the
If something is ___________ it means that it's one of a kind. art out of the ordinary different original
A researcher is comparing the effectiveness of three devices designed to help people who snore. There are 120 people who snore participating in the experiment.
Butterflies moved from mainland Australia to into the Indonesian archipelago. For almost every new island colonized, the butterflies adapted to the new environm
2. You have the below template DNA strand. Draw the coding DNA strand and mRNA. Include which ends are 3’ and which are 5’. template DNA 3’ CCTACGGTTCGTACCCCGTA
Evaluate the expression (4÷1)2
