febreselisa5 febreselisa5

25-06-2020
Mathematics

contestada

PLEASE HELP is 48, 41, 50, 46 a solution??

Respuesta :

rosav2003 rosav2003

25-06-2020

No it’s not a solution.

Answer Link

rrhea56 rrhea56

25-06-2020

No it’s not a solution

Answer Link

Otras preguntas

Why do some people think the wall of peace in Paris is unsightly

On a long transcontinental flight, a middle-aged man gets up and exercises in the aisle, moving his hands, feet, arms, and legs as much as he can. he does this

Why was acetic anhydride used as the solvent in the conversion of trityl alcohol to trityl tetrafluoroborate?

how to simplify 9+(-2) minus 2

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

why did the almoravids declare war on ghana

The Okinawa and Amami Great Island are the biggest among the Ryukyu Islands. How were these bigger islands created?

Are air temperatures over land always higher than the air temperatures over the ocean

Complete with the correct direct object pronoun: Yo no veo el monumento. ¿Tú _______ ves? Question 11 options: lo la los las Question 12 (2 points) Question 12

if a person consumes excess carbohydrate and sugar, those excess sugar can go through an anabolic process that produces