martinggl07 martinggl07

26-05-2020
Mathematics

contestada

The segments shown below could form a triangle
O A True
O B. False

The segments shown below could form a triangle O A True O B False class=

Respuesta :

26-05-2020

Answer:

A

Step-by-step explanation:

The triangle is an isosceles triangle with 2 sides are equal and the base .

Answer Link

lindseydh27 lindseydh27

26-05-2020

Answer:

B

Step-by-step explanation:

Answer Link

Otras preguntas

how many atoms are present in 4.0 mol of sodium

Describe two ways in which bacteria and the fungus Penicillium are similar? Describe two ways in which bacteria and the fungus Penicillium are different?

A carton measures 3 feet by 2 feet by 2 feet. A machine can fill the carton with packing material in 3 seconds. How long would it take to fill a carton that mea

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Can someone help me with this problem... #20

A single stranded DNA has a base sequence of 5'GACTCCGTAACGGTTAACC3'.What DNA sequence will base pair

what would you call a object that makes people shut up

Solve y=5x-8 and y=6x+3 by elimination

A machine drops 74 milliliters of liquid into a beaker every minute. Using an empty beaker, Sarah started the machine and left the room. When she returned, the