adamavalos7711 adamavalos7711

26-05-2020
Mathematics

contestada

What is Negative three-fourths + 2 and three-fourths? 3 and one-half 3 and three-fourths 2 and one-half 2

Respuesta :

iamjimbo iamjimbo

22-10-2020

Answer:

2

Step-by-step explanation:

Answer Link

kenziperry2 kenziperry2

22-01-2021

Answer:

2

Step-by-step explanation:

Answer Link

Otras preguntas

The price of a new car is 16000$ Mr Mar paid 15% of the price as a down payment how much does he still owe? (Please help and explain)

If 1+4=5 what is 8+11

a dime is flipped and a six-sided die is rolled what is the probability of flipping heads and rolling an odd number

how are the four earths systems connected

Can somebody please explain to me how the acceleration in simple hormonic motion is proportional to the displacement..

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

what stress force on a reverse fault?

If you drink a soda with sugar, what happens to your blood glucagon levels?

find the quotient of 3870 and 18

Explain lt Explain why the formula for finding the surface area of a rectangular prism is helpful. I NEED HELP !