tonygomez663 tonygomez663

23-04-2020
Mathematics

contestada

What is the approximate Probability of drawing a Red Face Card from a standard deck of shuffled cards?
A)23.1%
B)19.2%
C)15.4%
D)11.5%

Respuesta :

jayyybirddd2 jayyybirddd2

27-04-2020

Answer: D. 11.5%

Step-by-step explanation:

Answer Link

Otras preguntas

Write an entry for your blog which describes a place you have visited which has affected you or stayed in your memory and explain why this is so

If a DNA template strand has a sequence of 3' TACAATGTAGCC 5', then the RNA produced from it will be which sequence? A.) 3' AUGUUACAUCGG 5'. B.) 3' TACAATGTAGCC

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

Write an entry for your blog which describes a place you have visited which has affected you or stayed in your memory and explain why this is so

This is Super Confusing to me

Who discovered polio vaccine

Based on your understanding of sex linkage, describe in detail why most hemophiliacs are male. Can females have hemophilia? Describe how they could inherit this

f(x)= 3/x+2-square root x-3

Make a phrase with each of them for me please 1) Beneficial 2) benefited 3) Breath 4) Brilliant Thank you so much ! Please , no grammars mistakes

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC