luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

Simplify 8h + 9h -2h + 7 + 9 when h=4
PLEASE HELP!!!!!! what is the simplified expression to represent the area of the shaded region???
Joey is able to button his shirt and cut his food alone. Joey has developed:_________.A. handedness.B. gross motor skills.C. fine motor skills.D. None of these
You throw a 20-N rock vertically into the air from ground level. You observe that when it is a height 14.8m above the ground, it is traveling at a speed of 25.0
If a lab fire erupts, immediately * throw water on the fire notify your teacher O run for the fire extinguisher О open the windows
Jubal wrote the four equations below. He examined them, without solving them, to determine which equation has no solution. 7 x + 1 = 7 x+ 1. 3 x + 2 = 3 x minus
To print a budget:________. 1. From the Company Center, select Company & Financials > Budgets 2. From the Reports Center, select Budgets & Forecasts
What is true about the number 2.586? Check all that apply. The 8 is in the hundredths place. The 6 is in the thousandths place. The 5 is in the ones place. This
evaluate 70 divided by root 10 +root 20 +root 40 - root 80 , if root 10= 3.16 and root 5 =2.24
what's the steps used to solve modeling problems in the correct order​