luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

im on od plz hurry Background info-----You're a member of a small group that has been working on an important company project for the last year, and you have be
Need help with questions anyone
If x is a number in the interval [2, 7) state all integers that satisfy the given inequality above.
Give Three Examples of specialised input devices that would help a visually impaired user ?
PLEASE TELL ME FEEDBACK, THATS ALL I WANT. First and foremost, I believe that homework is not beneficial for students because it causes stress. To start, stress
Do you read a buret from top to bottom?
Please can you find the gradient of this line.
How are the functions f and g given by f(x) = (1.05)^x and g(x) = e^0.05x similar? How are they different?
7[tex]\frac{7}{8}[/tex] + 5[tex]\frac{13}{16}[/tex]
This one number 4 What to do