Sammydddd Sammydddd

21-04-2020
Mathematics

contestada

In a triangle ABC, if angle B= 60° and the ratio of two sides is a: C= 2: sqrt3 + 1, then angle A=
45°
40°
35
55°

Respuesta :

jason767 jason767

21-04-2020

I’m pretty sure the answer is 45

Answer Link

Otras preguntas

Find the highest common factor (HCF) of 90

please solve with solution thankyou!!!

Use a two-dimensional model and the dimensions provided to calculate the circumference and area of the flower. Round to the nearest tenth, if necessary. circumf

LGHK is a straight angle. Find ∠LHK m∠LHK=

How does the structure of the excerpt add meaning to the passage?

HELP HELP HELPP Solve for x: 3( + 1) − 7( − 1) = 3(2 − 4)

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

Can someone help me it geometry

e) 8×35=8x(x)=(8x_x_=_x_ f) 1.6 x 35 = 1.6 x(x) = (1.6 x_) x_=help plswase i give crown +5 stars

The pieces of ice float on water ? give reason