Chris2412 Chris2412

25-07-2016
Mathematics

contestada

What is the surface area of the figure made from this net?

What is the surface area of the figure made from this net class=

Respuesta :

Narawhal Narawhal

03-07-2017

The surface area of the figure is 468 inches².

Answer Link

luffygamer1991 luffygamer1991

28-04-2020

Answer:

The surface area of the figure is 468 inches²

Answer Link

Otras preguntas

The attention of the British government was diverted from this situation by wars with ____ and ____.

1) Which of the following best describes a chemical mixture? A compound made from different elements A substance made through chemical bonding When two substanc

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

What is one reason for early english victories during the hundred year’s war? A. the english had superior weapons, such as the english longbow B. the french wer

3x4+10-5+20-5+15-19+5+100+1,000+20+70+1-12+780

Which of the following transactions is reported on the government-wide financial statements? Multiple Choice An interfund loan from the General Fund to a specia

Design a simple experiment to distinguish between hydrophilic and hydrophobic substances. You start by adding equal amounts of vinegar and oil to a container. A

Solve four and two fifths plus two and two thirds.

The first coin I pull from my bag is a penny, the second coin I pull from my bag is a penny therefore I reason that all the coins in my bag are pennies. This is

Removing which ordered pair from the table would make the relation a function of X