bri2421 bri2421

27-01-2020
Mathematics

contestada

If a runner ran 102 meters in 12 seconds, how many meters did he/she run per second

Respuesta :

texaschic101 texaschic101

27-01-2020

Answer:

Step-by-step explanation:

102 meters in 12 seconds = (102 / 12) = 8.5 meters per second

Answer Link

Galaxy2105 Galaxy2105

27-01-2020

Answer:8.5 meters per second

Step-by-step explanation:you have to divide 102 by 12 and you get 8.5 meters per second

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

What is an element? 1. A substance made of more than one type of atom. 2. A substance that is made of water. 3. A substance that is made of no atoms. 4. A su

how much power is needed to lift a box with a force of 780 newtons over a distance of 2 meters in 45 seconds

2. Why does Jem refer to Scout as "Angel May"?

I will mark brainly, help me with this question please.

client quietly paces in the ed waiting area with his hands on his hips and rubbing his mid-lower left side. he has a flat facial expression. which factor is mos

Pls help on #7 I will give brainiest ! 7th grade level

What is the y-intercept of y = 4x? Choose 1 answer:

Help help help math math

A student randomly draws a card from a standard deck and checks.