gharsh8104 gharsh8104
  • 25-05-2016
  • Chemistry
contestada

how many outer rings does iodine have

Respuesta :

TrynTrynJ
TrynTrynJ TrynTrynJ
  • 25-05-2016
53 if your talking about electrons. 74 if your talking about neutrons. energy levels=5 Hope this helps☺️
Answer Link

Otras preguntas

plz help what is the answer.
what is 7/8ths of 40
:Select the correct text in the passage .Which lines in this excerpt from Phillis Wheatley's poem "Goliath of Gath" contain examples of figurative language? The
In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign
dont knwo the answers for question 4,5,6
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
PLEASE HELP AND EXPLAIN!!! (ASAP) A freight train left Seoul and traveled north at an average speed of 15.6 km/h. A passenger train left 3.9 hours later and tra
10(x+3)=9 mmmmmmmmmmmmmmmmm
Becca had 13/15 of a yard of ribbon to use for her crafts projects. She used 3/7 of a yard to make a bow. How much ribbon, r, does Becca have left? Set up an e
the most important benefit a dificult amendment process is that it