terrysizemore666
terrysizemore666 terrysizemore666
  • 24-01-2019
  • Biology
contestada

Choose all the answers that apply. Which of the following products is made using wood?
pencil
newspaper
cardboard
books
toothpicks

Respuesta :

almaee
almaee almaee
  • 24-01-2019
all of the above are made using wood.
Answer Link
clara654 clara654
  • 25-01-2019
All had made of wood
Answer Link

Otras preguntas

60 is what percent of 145
What was WEB Du Bois’s Plan to help get African Americans their equality?
DNA tacaggtacccgaacccaattta
What is the correct way to carry an arrangement made in a fragile container
What are the steps to divide 9,317 by 95
how do changes in nutrient affect biodivesity
If a ball is thrown upward, how fast would it have to be thrown to reach a maximum height of 29m? How long was the ball in the air when it reached this height?
Question 1 Fill in the blank with the correct preterite form of the verb IR. Mariana y Esteban____________ al zoológico, ¿no? Answer for Blank 1: Question 2
What is the role of government in natural law? 15 points
Which of the following describes how slavery changed the life of Africans in North America? A. Many slaves converted to Christianity, but they integrated tra