joannamiller94
joannamiller94 joannamiller94
  • 22-12-2018
  • English
contestada

He's a diligent student who sincerely wants to improve his critical reading skills, Alphonse records his summaries, responses, and questions about the various materials he's assigned to read in a/an

A. Annotation notebook
B. Study Guide
C. Response Journal
D. Summary folder

Relax

Respuesta :

vanessa2c3r
vanessa2c3r vanessa2c3r
  • 22-12-2018

i think maybe its A?

Answer Link

Otras preguntas

how to find the average range of cells A1:A10
How are glial cells and neurons alike and how are they different. Give 3 sentences for each
I need somebody's help..
why did the united states fail to join the league of nations
The number of cells in an average-sized adult human is on the order of 10^14 cells. Use this information, and the estimate that the length of DNA contained in e
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Perpendicular lines intersect to form __________________ angles
what would you call a object that makes people shut up
How do short-term goals differ from long-term goals?
Which prefix means 1/10 of a unit in the metric system