valerie2027posada valerie2027posada
  • 24-04-2024
  • Biology
contestada

Codons
Which amino acids does this mRNA strand code for?
*You must spell out the entire name of the amino acid*

5'CCGGAUGUCCGUAUAACGGC3'

Respuesta :

Otras preguntas

Neil had some olive oil.  He used 1/5 liter to make a salad dressing.  There was 1/2 liter of olive oil remaining in the bottle. What amount of olive oil did Ne
what did fascists believe was necessary to achieve order in a society
what word best describe chlorophyll
Neil had some olive oil.  He used 1/5 liter to make a salad dressing.  There was 1/2 liter of olive oil remaining in the bottle. What amount of olive oil did Ne
How many moles of sodium hydroxide are produced when 1.00 mol sodium peroxide reacts with water
What were the causes of the cold war?
Balance the equation : ...NO2 + ...O2 + ...H2O = ...HNO3
The density of mercury is 13.6 g/mL. What is the volume of a 155-gram sample of mercury?
who was not free in medieval England
How do conservationists make use of watersheds and ecozones? Why is this important?