macyart macyart
  • 22-04-2024
  • Chemistry
contestada

Calculate the molar solubility of CaF2
in a solution containing 0.303 M
of Ca(NO3)2
. The Ksp
value for CaF2
is 1.46×10−10

Respuesta :

Otras preguntas

Jade Jewelers issued 15,000 shares of $1 par value stock for $20 per share. What is true about the journal entry to record the issuance? A) Debit Additional Pai
50 Points! Multiple choice geometry question. Photo attached. Thank you!
Use cylindrical coordinates Evaluate x2 dV, where E is the solid that lies within the cylinder x2 + y2 = 4, above the plane z = 0, and below the cone z2 = 25x2
indicate how Hans-Georg Gadamer and Rudolf Steiner's views could influence your classroom practice.​
How many licks does it take to get to the center of a Tootsie Pop?
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
an object is placed 10 cm to the left of a converging lens that has a focal length of 20 cm. describe what the resulting image will look like
Alguien que me explique como se resuelve esta operación por pasos 4(2-x) <-x+5
Test a claim on three locations ?
PLEASE HELP ASAP :))