mjasmine4212 mjasmine4212
  • 21-04-2024
  • Physics
contestada

An ideal transformer has 50 turns in its primary and 400 turns in its secondary. 12-v ac is connected to the primary. what ispower supplied to primary

Respuesta :

Otras preguntas

What two numbers add up to 13 and multiply to 10? Thanks!
Correct Answer Gets Brainliest Which statement best describes the outcome of the Persian Wars? A. The Greeks were able to stop a Persian invasion, and the Persi
Eight trials are simulated. The results are shown in the table. Simulation 105 104 110 112 114 106 108 109 What is the estimated margin of error, using standard
the amount of money spent weekly on cleaning maintenance and repairs at a large restaurant was observed over a long period of time to be approximately normally
Calendars help you plan out your school year T or F
Which sentence contains a misplaced modifier? a) I can't believe I heard you complain about your surprise party! b) Reading Paul's essay, it was apparent his r
What types of organisms have ligaments?
why is it good to have holes in your t-shirts?
Help me I don’t understand.Brainliest and 30 points
DNA tacaggtacccgaacccaattta