v54fngpqpj v54fngpqpj

22-05-2023
Mathematics

contestada

2(3-a) (-2)(a − 3) = -(3a-2)

PLEASE HELP MEEEEE

Respuesta :

Otras preguntas

Research the advantages socialists/communists claimed they had over the free enterprise system. Prepare a 200 word argument defending either socialism/communism

Which individual has the highest risk for developing anorexia nervosa?

Question 36 Unsaved Rewrite the following sentence with a direct object pronoun: Yo tengo el libro. Question 36 options: Yo lo tengo. Yo la tengo.

Brain regions important to memory begin to atrophy as we age. this is best illustrated by the fact that the blood-brain barrier breaks down beginning in the ___

Giving back that lost wallet with all the money showed her integrity.

The _______________________domain establishes the context and business view for a risk evaluation and guarantees that risk activity aligns with the business goa

A client is admitted to the emergency department after a train derailment. the primary health care provider orders staff members to monitor vital signs, perform

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Which of these is appropriate concert behavior during live performances?

Which point is an exact solution to the system y = -6(0.75)^x and y = 4(x - 1)? (0, -6) (-1, -8) (-2, -12) (-4.5, -22)